Stem-loop sequence lus-MIR156d

AccessionMI0021200
DescriptionLinum usitatissimum miR156d stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
     u    u   -  uaca    ua  ug              --           ----     c uc c    ga 
5' gu uuug gua ga    uaca  ca  uauugacagaagaa  agagagcacaa    cugaa a  c cagg  a
   || |||| ||| ||    ||||  ||  ||||||||||||||  |||||||||||    ||||| |  | ||||  a
3' ca aaac cau cu    augu  gu  auaacugucuucuu  ucucucguguu    gacuu u  g gucc  u
     u    -   a  -uaa    -c  ca              cu           uucc     c uu u    gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156d

Accession MIMAT0027180
Sequence

31 - 

ugacagaagaaagagagcac

 - 50

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).