Stem-loop sequence lus-MIR156c

AccessionMI0021199
DescriptionLinum usitatissimum miR156c stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -gguu  u         -                 uuu   -     c uc 
5'      ug ugacagaag auagagagcacagauga   ugg gaugu g  a
        || ||||||||| |||||||||||||||||   ||| ||||| |  a
3'      ac acugucuuu uaucucucguguuuacu   acc cuaca c  a
   cuuuc  u         g                 ---   g     c cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156c

Accession MIMAT0027179
Sequence

7 - 

uugacagaagauagagagcac

 - 27

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).