Stem-loop sequence lus-MIR156i

AccessionMI0021198
DescriptionLinum usitatissimum miR156i stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
      ug        aggu   uu     auauu   u u           -            u   cu       cuc  acc    a 
5' aua  aaggaaag    gga  uggau     ggu g ugacagaagau agagagcacaga gau  gggaugu   ga   auau u
   |||  ||||||||    |||  |||||     ||| | ||||||||||| |||||||||||| |||  |||||||   ||   ||||  
3' ugu  uuucuuuc    ccu  accua     cca c acugucuucug ucucucguguuu cua  cucuacg   cu   uaua a
      gu        -gau   --     --cuu   - u           a            c   -c       --u  --a    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156i

Accession MIMAT0027178
Sequence

38 - 

uugacagaagauagagagcac

 - 58

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).