Stem-loop sequence lus-MIR156b

AccessionMI0021181
DescriptionLinum usitatissimum miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
    ua       u     uuu    uu   a    uuuug     u  u u         -              a  u a        aau 
5' u  gaggaga gaagg   uggg  gag gccc     ggaua gu g ugacagaag auagagagcacaga ga g ugggauac   u
   |  ||||||| |||||   ||||  ||| ||||     ||||| || | ||||||||| |||||||||||||| || | ||||||||    
3' a  uuuuucu cuucc   accu  cuc cggg     cuugu ca c acugucuuu uaucucucguguuu cu c acucuaug   g
    gc       c     --u    -u   -    -----     c  - u         g              c  u -        aua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156b

Accession MIMAT0027161
Sequence

49 - 

uugacagaagauagagagcac

 - 69

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).