Stem-loop sequence lus-MIR399c

AccessionMI0021174 (change log)
DescriptionLinum usitatissimum miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

1 open access papers mention lus-MIR399c
(18 sentences)

Stem-loop
   gua   --uu     u   a   ua a      cu      a         a cca          g caua 
5'    cug    gcagu ggg aau  c gggcaa  aucucu uuggcaggc g   ugcacuuaga a    c
      |||    ||||| ||| |||  | ||||||  |||||| ||||||||| |   |||||||||| |     
3'    ggc    cguca cuc uua  g cccguu  uagagg aaccgucug c   acgugaaucu u    u
   cga   uauu     u   c   gc g      --      a         c ---          g caau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lus-miR399c

Accession MIMAT0027154
Sequence

94 - 

ugccaaaggagauuugcccgg

 - 114

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).