Stem-loop sequence lus-MIR399b

AccessionMI0021173 (change log)
DescriptionLinum usitatissimum miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

1 open access papers mention lus-MIR399b
(18 sentences)

Stem-loop
   gagua     -   -    aa   u     a    a          a   -  ug  g 
5'      guagu gaa gaau  cag gcaau cucc uuggcaggaa uau ua  au a
        ||||| ||| ||||  ||| ||||| |||| |||||||||| ||| ||  || u
3'      cauca cuu cuua  guc cguua gagg aaccgucuuu gua au  ua g
   ---cc     a   a    ac   c     a    a          g   u  gu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lus-miR399b

Accession MIMAT0027153
Sequence

75 - 

ugccaaaggagaauugcccug

 - 95

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).