Stem-loop sequence bta-mir-6123

AccessionMI0021141 (change log)
DescriptionBos taurus miR-6123 stem-loop
Literature search

1 open access papers mention bta-mir-6123
(1 sentences)

Stem-loop
   -a       g  aag    c          u  u  uucaa 
5'   gccugcu cc   ccca guucaaaggc gu uc     a
     ||||||| ||   |||| |||||||||| || ||      
3'   cgggcga gg   gggu cgaguuuccg cg gg     g
   ga       a  gaa    -          c  u  uaauu 
Get sequence
Deep sequencing
921 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 58332856-58332937 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-6123
bta-mir-6123chr13: 58332856-58332937 [+]
bta-mir-296chr13: 58333114-58333191 [+]
Database links

Mature sequence bta-miR-6123

Accession MIMAT0024596
Sequence

8 - 

ugccaagcccacguucaaagg

 - 28

Get sequence
Deep sequencing904 reads, 63 experiments
Evidence experimental; Illumina [1-3]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
3