Stem-loop sequence bta-mir-6122

AccessionMI0021140 (change log)
DescriptionBos taurus miR-6122 stem-loop
Stem-loop
   g    uaccag      g   u    cc   g 
5'  cagu      ucaguu uac uuau  agu c
    ||||      |||||| ||| ||||  |||  
3'  guua      agucaa aug agua  uca u
   g    ---uca      -   u    ua   a 
Get sequence
Deep sequencing
45 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 43660500-43660561 [+]
sense
ENSBTAT00000020447 ; REL-201; intron 1
Database links

Mature sequence bta-miR-6122-5p

Accession MIMAT0024594
Sequence

12 - 

ucaguuguacuuuauccagugc

 - 33

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-6122-3p

Accession MIMAT0024595
Sequence

36 - 

acuauaugauguaaacugaac

 - 56

Get sequence
Deep sequencing45 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).