Stem-loop sequence bta-mir-6120

AccessionMI0021138 (change log)
DescriptionBos taurus miR-6120 stem-loop
Stem-loop
   --------uc      c    u    -      ----u  u 
5'           cuguuc cguu uuca caugug     ac g
             |||||| |||| |||| ||||||     ||  
3'           gauagg gcaa aggu guauac     ug a
   gagugcccac      u    c    u      uaguu  u 
Get sequence
Deep sequencing
4065 reads, 10 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 46077154-46077224 [+]
sense
ENSBTAT00000022345 ; CSNK1G2-201; intron 1
Database links

Mature sequence bta-miR-6120-5p

Accession MIMAT0024590
Sequence

3 - 

cuguucccguuuuucacaugug

 - 24

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1-3]
Predicted targets

Mature sequence bta-miR-6120-3p

Accession MIMAT0024591
Sequence

41 - 

uauguuggacaacguggauagc

 - 62

Get sequence
Deep sequencing4062 reads, 70 experiments
Evidence experimental; Illumina [1-3]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
3