Stem-loop sequence bta-mir-6119

AccessionMI0021137 (change log)
DescriptionBos taurus miR-6119 stem-loop
Literature search

2 open access papers mention bta-mir-6119
(2 sentences)

Stem-loop
   ----a     a   -         u      a    uucuu 
5'      uuuug gag guaaaaaau gauuug cuag     u
        ||||| ||| ||||||||| |||||| ||||     a
3'      aaaac cuc cauuuuuua cuaaac gauc     a
   caaga     -   u         -      -    uacac 
Get sequence
Deep sequencing
61290 reads, 654 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 4014633-4014709 [-]
intergenic
Database links

Mature sequence bta-miR-6119-5p

Accession MIMAT0024588
Sequence

7 - 

agagguaaaaaauugauuugacu

 - 29

Get sequence
Deep sequencing60421 reads, 76 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-6119-3p

Accession MIMAT0024589
Sequence

48 - 

gcaaaucauuuuuuacucuccaa

 - 70

Get sequence
Deep sequencing868 reads, 67 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).