Stem-loop sequence bta-mir-2285l

AccessionMI0021136 (change log)
DescriptionBos taurus miR-2285l stem-loop
Gene family MIPF0000747; mir-2284
Literature search

12 open access papers mention bta-mir-2285l
(16 sentences)

Stem-loop
   uu            --u       u  a       ag   c 
5'   uuggguuggcca   aguucau cg guuuuuc  uaa a
     ||||||||||||   ||||||| || |||||||  |||  
3'   aacucaaccggu   ucaagua gc caaaaag  auu c
   au            uuu       c  c       ag   c 
Get sequence
Deep sequencing
147 reads, 2.33 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 104301519-104301600 [-]
sense
ENSBTAT00000010925 ; FN1-201; intron 7
ENSBTAT00000010922 ; FN1-202; intron 7
ENSBTAT00000010926 ; FN1-203; intron 7
Database links

Mature sequence bta-miR-2285l

Accession MIMAT0024587
Sequence

50 - 

aaaacccgcaugaacuuuuuggc

 - 72

Get sequence
Deep sequencing99 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).