Stem-loop sequence bta-mir-2285j-2

AccessionMI0021134 (change log)
DescriptionBos taurus miR-2285j-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285j-2
(15 sentences)

Stem-loop
   gc      c           c   -   -  ----g  --u  uau 
5'   auuggg uggccaaaaag uuc uuc gg     cu   cc   a
     |||||| ||||||||||| ||| ||| ||     ||   ||    
3'   ugaccc accgguuuuuc aag aag cc     ga   gg   a
   ca      a           -   c   a  aaaaa  cau  uag 
Get sequence
Deep sequencing
3752 reads, 10.6 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 3219072-3219156 [-]
intergenic
Database links

Mature sequence bta-miR-2285j

Accession MIMAT0024585
Sequence

51 - 

aaaaaccagaacgaacuuuuug

 - 72

Get sequence
Deep sequencing7441 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).