Stem-loop sequence bta-mir-2285j-1

AccessionMI0021133 (change log)
DescriptionBos taurus miR-2285j-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285j-1
(15 sentences)

Stem-loop
   -a           -       g        --  g 
5'   uuggucaaaaa uuuguuu gguuuuuc  ca u
     ||||||||||| ||||||| ||||||||  || u
3'   aaccgguuuuu aagcaag ccaaaaag  gu g
   cc           c       a        uu  a 
Get sequence
Deep sequencing
3731 reads, 13.4 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 1356425-1356493 [+]
intergenic
Database links

Mature sequence bta-miR-2285j

Accession MIMAT0024585
Sequence

41 - 

aaaaaccagaacgaacuuuuug

 - 62

Get sequence
Deep sequencing7441 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).