Stem-loop sequence bta-mir-2285i

AccessionMI0021132 (change log)
DescriptionBos taurus miR-2285i stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285i
(15 sentences)

Stem-loop
   ca       ug        a   a      c      c 
5'   gguuggc  aaaaguuc uuc gguuuu ccauag a
     |||||||  |||||||| ||| |||||| ||||||  
3'   ccaaccg  uuuucaag aag ccaaaa gguauu g
   ac       gu        c   g      a      c 
Get sequence
Deep sequencing
8173 reads, 152 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 47090086-47090163 [+]
intergenic
Database links

Mature sequence bta-miR-2285i

Accession MIMAT0024584
Sequence

49 - 

aaaaccggaacgaacuuuuugg

 - 70

Get sequence
Deep sequencing7995 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).