Stem-loop sequence bta-mir-2285h

AccessionMI0021131 (change log)
DescriptionBos taurus miR-2285h stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285h
(15 sentences)

Stem-loop
   agu             a       a  ca           aag 
5'    auuggguuggcca aaaguuc uu  gguuuuuccgu   a
      ||||||||||||| ||||||| ||  |||||||||||   u
3'    uaauccaaccggu uuucaag aa  ccaaaagggua   g
   aau             a       c  ag           auu 
Get sequence
Deep sequencing
729 reads, 28.4 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 15730204-15730292 [+]
sense
ENSBTAT00000023803 ; COG3-201; intron 22
Database links

Mature sequence bta-miR-2285h

Accession MIMAT0024583
Sequence

54 - 

gaaaaccgaaacgaacuuuaug

 - 75

Get sequence
Deep sequencing61 reads, 35 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).