Stem-loop sequence bta-mir-2285f-1

AccessionMI0021128 (change log)
DescriptionBos taurus miR-2285f-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2285f-1
(24 sentences)

Stem-loop
   u  g               ga     -  ugcac 
5'  ug ccaaaaaguucauuu  guuuu cc     u
    || |||||||||||||||  ||||| ||     a
3'  au gguuuuucaaguaag  caaaa gg     u
   a  g               uc     a  uauuc 
Get sequence
Deep sequencing
14224 reads, 201 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 49702253-49702322 [+]
antisense
ENSBTAT00000023134 ; TBK1-201; intron 4
Database links

Mature sequence bta-miR-2285f

Accession MIMAT0024581
Sequence

45 - 

aaaaccugaaugaacuuuuugg

 - 66

Get sequence
Deep sequencing28344 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).