Stem-loop sequence bta-mir-2285e-2

AccessionMI0021127 (change log)
DescriptionBos taurus miR-2285e-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

12 open access papers mention bta-mir-2285e-2
(16 sentences)

Stem-loop
   gauu                ug         ---  a 
5'     ggccaaaaaguucguu  gguuuuucu   gg a
       ||||||||||||||||  |||||||||   || c
3'     ccgguuuuucaagcaa  ccaaaaagg   uc a
   -cac                gu         uau  u 
Get sequence
Deep sequencing
24851 reads, 98.6 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 89979593-89979665 [+]
intergenic
Database links

Mature sequence bta-miR-2285e

Accession MIMAT0024580
Sequence

48 - 

aaaccugaacgaacuuuuuggc

 - 69

Get sequence
Deep sequencing14035 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).