Stem-loop sequence bta-mir-2285e-1

AccessionMI0021126 (change log)
DescriptionBos taurus miR-2285e-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

12 open access papers mention bta-mir-2285e-1
(16 sentences)

Stem-loop
                     a   c  ug  ag 
5' gccaaaaaguucguucgg uuu uc  ua  c
   |||||||||||||||||| ||| ||  ||   
3' cgguuuuucaagcaaguc aaa ag  gu  u
                     c   u  gu  gg 
Get sequence
Deep sequencing
12381 reads, 43.7 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 158734396-158734459 [+]
intergenic
Database links

Mature sequence bta-miR-2285e

Accession MIMAT0024580
Sequence

43 - 

aaaccugaacgaacuuuuuggc

 - 64

Get sequence
Deep sequencing14035 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).