|
miRBase |
|
Stem-loop sequence bta-mir-2284y-1 |
|||||
| Accession | MI0021125 | ||||
| Description | Bos taurus miR-2284y-1 stem-loop | ||||
| Gene family | MIPF0000747; mir-2284 | ||||
| Stem-loop |
aauaaccccuguua - ac cuugauc g c c u uu aggccug caga uug uauuggguuggccaaaaa uu guu ggg uu c ||||||| |||| ||| |||||||||||||||||| || ||| ||| || uucgggu gucu aac auaacccaaccgguuuuu aa caa ccc ga c ------------cc u -- ------- g u a u uu |
||||
| Genome context |
|
||||
Mature sequence bta-miR-2284y |
|
| Accession | MIMAT0024579 |
| Sequence |
52 - aaaaguucguucggguuuuuc - 72 |
| Evidence | experimental; Solexa [1-2] |
References |
|
| 1 |
PMID:22298343
"Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells"
J Cell Biochem. 113:2098-2111(2012).
|
| 2 |
PMID:21912509
"Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle"
Int J Biol Sci. 7:1016-1026(2011).
|