Stem-loop sequence bta-mir-652

AccessionMI0021123 (change log)
DescriptionBos taurus miR-652 stem-loop
Gene family MIPF0000333; mir-652
Literature search

4 open access papers mention bta-mir-652
(13 sentences)

Stem-loop
   acgaau  cua                  gagag           cauag 
5'       gg   ugcacugcacaacccuag     ggugccauuca     a
         ||   ||||||||||||||||||     |||||||||||     c
3'       cc   acgugacguguugggauc     ccgcgguaagu     u
   -cacau  aac                  ----a           uaaga 
Get sequence
Deep sequencing
8695 reads, 70.7 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 63688261-63688358 [+]
sense
ENSBTAT00000053988 ; TMEM164-201; intron 1
Database links

Mature sequence bta-miR-652

Accession MIMAT0024578
Sequence

61 - 

aauggcgccacuaggguugug

 - 81

Get sequence
Deep sequencing8107 reads, 75 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).