Stem-loop sequence bta-mir-450b

AccessionMI0021121 (change log)
DescriptionBos taurus miR-450b stem-loop
Gene family MIPF0000128; mir-450
Literature search

5 open access papers mention bta-mir-450b
(8 sentences)

Stem-loop
   --------------        uuu     u       ug -         
5'               aaaauuau   ugcaa auguucc  a auauuuaa 
                 ||||||||   ||||| |||||||  | ||||||| u
3'               uuuugaua   acguu uacaagg  u uaugaaua 
   gauuuaugacuaug        ccu     u       gu a         
Get sequence
Deep sequencing
14333 reads, 75 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18281872-18281957 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-450b
bta-mir-424chrX: 18288411-18288506 [-]
bta-mir-503chrX: 18288067-18288149 [-]
bta-mir-3601chrX: 18283115-18283192 [+]
bta-mir-542chrX: 18283105-18283201 [-]
bta-mir-450a-2chrX: 18282193-18282284 [-]
bta-mir-450a-1chrX: 18282042-18282123 [-]
bta-mir-450bchrX: 18281872-18281957 [-]
Database links

Mature sequence bta-miR-450b

Accession MIMAT0024576
Sequence

9 - 

uuuugcaauauguuccugaaua

 - 30

Get sequence
Deep sequencing14273 reads, 68 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).