Stem-loop sequence bta-mir-3141

AccessionMI0021117 (change log)
DescriptionBos taurus miR-3141 stem-loop
Stem-loop
   -----------------ccgcccccgucuccacccc    ---  c  a       agu 
5'                                     gccc   cc gg gccgcug   g
                                       ||||   || || |||||||    
3'                                     uggg   gg cc cggcgac   g
   ggcgaaggaggaggugggcgggagaacagacuccuu    cca  a  c       ggc 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 73710201-73710300 [-]
intergenic
Database links

Mature sequence bta-miR-3141

Accession MIMAT0024573
Sequence

77 - 

gagggcggguggaggagg

 - 94

Get sequence
Deep sequencing13 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).