Stem-loop sequence bta-mir-149

AccessionMI0021115 (change log)
DescriptionBos taurus miR-149 stem-loop
Gene family MIPF0000274; mir-149
Literature search

4 open access papers mention bta-mir-149
(6 sentences)

Stem-loop
   -g     -    a   u u g      g     a     -gu   u 
5'   ccggc gccc ggc c g cuccgu ucuuc cuccc   gug g
     ||||| |||| ||| | | |||||| ||||| |||||   |||  
3'   ggccg cggg ucg g c ggggca ggagg gaggg   cac u
   ag     g    g   u u g      g     -     agc   c 
Get sequence
Deep sequencing
2967 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 120921662-120921751 [+]
sense
ENSBTAT00000018329 ; GPC1-201; intron 1
antisense
Database links

Mature sequence bta-miR-149-5p

Accession MIMAT0024570
Sequence

15 - 

ucuggcuccgugucuucacuccc

 - 37

Get sequence
Deep sequencing2872 reads, 67 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-149-3p

Accession MIMAT0024571
Sequence

55 - 

gagggagggacgggggcugugc

 - 76

Get sequence
Deep sequencing95 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).