Stem-loop sequence bta-mir-1277

AccessionMI0021114 (change log)
DescriptionBos taurus miR-1277 stem-loop
Gene family MIPF0001937; mir-1277
Literature search

1 open access papers mention bta-mir-1277
(1 sentences)

Stem-loop
   --   uc     u            g        ug au 
5'   acc  ccaaa auauauauauau uacguaug  u  a
     |||  ||||| |||||||||||| ||||||||  |   
3'   ugg  gguuu uauguauauaua augcauau  a  u
   uu   gu     u            g        gu ag 
Get sequence
Deep sequencing
866 reads, 1.45 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 2445343-2445420 [+]
sense
ENSBTAT00000042419 ; bta-mir-1277-201; exon 1
ENSBTAT00000024883 ; WDR44-201; intron 2
Database links

Mature sequence bta-miR-1277

Accession MIMAT0024569
Sequence

47 - 

uacguagauauauauguauuuu

 - 68

Get sequence
Deep sequencing257 reads, 31 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).