Stem-loop sequence cca-MIR396a

AccessionMI0021083 (change log)
DescriptionCynara cardunculus miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention cca-MIR396a
(3 sentences)

Stem-loop
   --                            aaaaau       uuaauucc      a    u 
5'   auguuuuuccacagcuuucuugaacuuu      ucaugug        guucuc agaa u
     ||||||||||||||||||||||||||||      |||||||        |||||| ||||  
3'   uacaaaagggugucgaaagaacuugaag      agugcac        uaagag uuuu c
   ag                            caaauu       -------u      c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR396a-5p

Accession MIMAT0024529
Sequence

7 - 

uuccacagcuuucuugaacuu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cca-miR396a-3p

Accession MIMAT0024530
Sequence

93 - 

guucaagaaagcugugggaaa

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).