Stem-loop sequence cca-MIR156c

AccessionMI0021066
DescriptionCynara cardunculus miR156c stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -  a  u         -           u      acau  a      au 
5'  gg ug ugacagaag auagagagcac gagagg    ga gugcau  a
    || || ||||||||| ||||||||||| ||||||    || ||||||  u
3'  cc au acugucuuc uauuucucgug uucuuc    cu cacgua  a
   u  c  u         a           u      ---g  c      au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence cca-miR156c

Accession MIMAT0024512
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).