Stem-loop sequence cca-MIR156b

AccessionMI0021065
DescriptionCynara cardunculus miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   aagaa         -      -             ------a     u       a 
5'      agcugacag aagaga gugagcauaugca       agcaa uguauag g
        ||||||||| |||||| |||||||||||||       ||||| |||||||  
3'      ucgacuguc uucucu cacucgugugcgu       uuguu acauauc a
   ----a         g      u             auucagg     c       a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence cca-miR156b

Accession MIMAT0024511
Sequence

9 - 

ugacagaagagagugagcaua

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).