Stem-loop sequence cca-MIR156a

AccessionMI0021064
DescriptionCynara cardunculus miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -------    a  -              g    gcuuuucuugcaugauauuggagggagg 
5'        ugac ga agagagugagcaca augg                            u
          |||| || |||||||||||||| ||||                             
3'        acug cu ucucucacucgugu uauc                            g
   uccaccc    c  a              g    aaaguucguauguuuaguaguagaucau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence cca-miR156a

Accession MIMAT0024510
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).