Stem-loop sequence mse-mir-279d

AccessionMI0021035 (change log)
DescriptionManduca sexta miR-279d stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   ---u     c      auuu   ug       u  cu       ucau       
5'     auaaa uugaug    uug  ggcgagu ug  ucugguu    guugcc 
       ||||| ||||||    |||  ||||||| ||  |||||||    ||||| g
3'     uauuu aacuac    gac  cugcuca ac  agaucag    caauga 
   cuuc     c      ---c   gu       u  cu       -uac       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668768.1: 162723-162824 [-]
intergenic
Clustered miRNAs
< 10kb from mse-mir-279d
mse-mir-279bJH668768.1: 163114-163212 [-]
mse-mir-279dJH668768.1: 162723-162824 [-]
Database links

Mature sequence mse-miR-279d

Accession MIMAT0024485
Sequence

61 - 

ugacuagauccauacucgucugc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).