Stem-loop sequence mse-mir-9b

AccessionMI0021026 (change log)
DescriptionManduca sexta miR-9b stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   agaaaagaagaga      u   uaa   u       u        g     -  au 
5'              guagau ggu   uua cuuuggu aucuagcu uauga gu  u
                |||||| |||   ||| ||||||| |||||||| ||||| ||  u
3'              caucua cca   aau gaggcca uggaucga auacu ca  u
   ------------g      -   -ug   u       u        a     a  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668478.1: 236456-236557 [-]
intergenic
Database links

Mature sequence mse-miR-9b

Accession MIMAT0024476
Sequence

67 - 

auaaagcuagguuaccggaguua

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).