Stem-loop sequence mse-mir-34

AccessionMI0021025 (change log)
DescriptionManduca sexta miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   aaa  a -aua      gc    uu        g     c       uua   c 
5'    ga g    agguug  cgcg  ggcagugu guuag ugguugu   ugu a
      || |    ||||||  ||||  |||||||| ||||| |||||||   |||  
3'    cu c    uccaac  gcgu  ccgucaca cgauc accgaca   aca u
   --g  a gaaa      gu    cu        g     -       ---   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668424.1: 260678-260780 [+]
intergenic
Clustered miRNAs
< 10kb from mse-mir-34
mse-mir-277JH668424.1: 251419-251521 [+]
mse-mir-34JH668424.1: 260678-260780 [+]
Database links

Mature sequence mse-miR-34

Accession MIMAT0024475
Sequence

24 - 

uggcagugugguuagcugguugu

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).