Stem-loop sequence mse-mir-9a

AccessionMI0021022 (change log)
DescriptionManduca sexta miR-9a stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   gac  caaaucc  c      c   cu          c     g    c  cc 
5'    gc       cg cgcggc cgu  cuuugguauc uagcu uagg gu  c
      ||       || |||||| |||  |||||||||| ||||| |||| ||  g
3'    cg       gc gcgcug gca  gaagccaugg auuga aucc cg  u
   --a  ----cac  u      a   uu          u     a    -  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668930.1: 82977-83078 [-]
intergenic
Clustered miRNAs
< 10kb from mse-mir-9a
mse-mir-9aJH668930.1: 82977-83078 [-]
mse-mir-306JH668930.1: 82546-82646 [-]
mse-mir-79JH668930.1: 82368-82471 [-]
Database links

Mature sequence mse-miR-9a

Accession MIMAT0024473
Sequence

63 - 

uaaaguuaugguaccgaaguua

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).