Stem-loop sequence mse-mir-79

AccessionMI0021021 (change log)
DescriptionManduca sexta miR-79 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   -   a  c  ---   c      ac       cg        cc    c   a 
5'  cgc ga ga   gcg gaugcg  gcuuugg  auuuagcu  guga gug a
    ||| || ||   ||| ||||||  |||||||  ||||||||  |||| ||| g
3'  gug cu cu   cgc cugcgc  cgaaacc  uagaucga  uacu cau c
   g   g  a  cac   c      ca       au        aa    -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668930.1: 82368-82471 [-]
intergenic
Clustered miRNAs
< 10kb from mse-mir-79
mse-mir-9aJH668930.1: 82977-83078 [-]
mse-mir-306JH668930.1: 82546-82646 [-]
mse-mir-79JH668930.1: 82368-82471 [-]
Database links

Mature sequence mse-miR-79

Accession MIMAT0024472
Sequence

59 - 

auaaagcuagauuaccaaagca

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).