Stem-loop sequence mse-mir-281

AccessionMI0020995 (change log)
DescriptionManduca sexta miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   gaaauaagaa   uauaa      a           -ua     c      a  gc 
5'           gca     ucuguu augaagagagc   uccgu gacagu uu  c
             |||     |||||| |||||||||||   ||||| |||||| ||  a
3'           cgu     aggcaa uauuucucucg   aggua cuguca aa  c
   --------aa   -----      g           uug     -      c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668342.1: 1204825-1204924 [+]
intergenic
Database links

Mature sequence mse-miR-281

Accession MIMAT0024446
Sequence

65 - 

cugucauggaguugcucucuuu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).