Stem-loop sequence mse-mir-279b

AccessionMI0020976 (change log)
DescriptionManduca sexta miR-279b stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   aagacagaccugcc     uu     ug      a          aa     uu u 
5'               acugg  gcagu  augggu uaggucuagu  cacag  u a
                 |||||  |||||  |||||| ||||||||||  |||||  |  
3'               ugacc  cguua  uacuca aucuagauca  guguc  a a
   -------------u     uu     gu      c          --     uu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668768.1: 163114-163212 [-]
intergenic
Clustered miRNAs
< 10kb from mse-mir-279b
mse-mir-279bJH668768.1: 163114-163212 [-]
mse-mir-279dJH668768.1: 162723-162824 [-]
Database links

Mature sequence mse-miR-279b

Accession MIMAT0024427
Sequence

66 - 

ugacuagaucuacacucauuga

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).