Stem-loop sequence mse-mir-998

AccessionMI0020972 (change log)
DescriptionManduca sexta miR-998 stem-loop
Gene family MIPF0000952; mir-998
Stem-loop
     g   gcg  acc       g   c      c        cg      - u 
5' gg ugu   gg   uggcgcg ccg gagcug aucccgug  gcugca g g
   || |||   ||   ||||||| ||| |||||| ||||||||  |||||| | c
3' cc aca   uc   accgcgc ggc cucgac uaggguac  cgaugu c u
     g   --a  ---       -   a      u        ca      g g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668351.1: 967040-967139 [-]
intergenic
Clustered miRNAs
< 10kb from mse-mir-998
mse-mir-11JH668351.1: 968468-968569 [-]
mse-mir-998JH668351.1: 967040-967139 [-]
Database links

Mature sequence mse-miR-998

Accession MIMAT0024423
Sequence

60 - 

uagcaccaugggauucagcuca

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).