Stem-loop sequence mse-mir-11

AccessionMI0020971 (change log)
DescriptionManduca sexta miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
   aaa   ag  aag     uu              c   c    gu    ugu 
5'    ugg  ug   cgcgu  uguggcuaggacuc gac guga  ugug   g
      |||  ||   |||||  |||||||||||||| ||| ||||  ||||    
3'    acc  ac   gugcg  auaucgaucuugag cug cacu  acac   u
   --c   aa  aag     gc              a   a    --    uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668351.1: 968468-968569 [-]
intergenic
Clustered miRNAs
< 10kb from mse-mir-11
mse-mir-11JH668351.1: 968468-968569 [-]
mse-mir-998JH668351.1: 967040-967139 [-]
Database links

Mature sequence mse-miR-11

Accession MIMAT0024422
Sequence

60 - 

caucacagucagaguucuagcu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).