Stem-loop sequence mes-MIR399a

AccessionMI0020967 (change log)
DescriptionManihot esculenta miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mes-MIR399a
(8 sentences)

Stem-loop
        -cg            -   c     c        -     gaugaucacuauucac 
5' auggu   aggaauggcagg cga ucucc uuggcaaa cggau                c
   |||||   |||||||||||| ||| ||||| |||||||| |||||                 
3' uacua   ucuuuaccgucc guu agagg aaccguuu gucua                a
        uaa            c   a     a        c     auacguaauuaaacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04003: 143-263 [+]
intergenic
Database links

Mature sequence mes-miR399a

Accession MIMAT0024418
Sequence

85 - 

ugccaaaggagaauugcccug

 - 105

Get sequence
Evidence not experimental

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).