Stem-loop sequence mmu-mir-3084-2

AccessionMI0020958 (change log)
Symbol MGI:Mir3084-2
DescriptionMus musculus miR-3084-2 stem-loop
Gene family MIPF0001536; mir-3084
Literature search

2 open access papers mention mmu-mir-3084-2
(3 sentences)

Stem-loop
   caaaua  -      uua   a       a    a 
5'       gu ugaagg   auu gcagagu acug a
         || ||||||   ||| ||||||| ||||  
3'       ca acuucc   uga cgucuua ugau u
   -aaaaa  g      -uc   c       a    a 
Get sequence
Deep sequencing
1248 reads, 2.41 reads per million, 83 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 60774329-60774397 [-]
sense
ENSMUST00000082962 ; Snora19-201; exon 1
ENSMUST00000025955 ; Eif3a-201; intron 9
Database links

Mature sequence mmu-miR-3084-5p

Accession MIMAT0014876
Previous IDsmmu-miR-3084*
Sequence

7 - 

guugaagguuaauuagcagagu

 - 28

Get sequence
Deep sequencing904 reads, 50 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3084-3p

Accession MIMAT0014877
Previous IDsmmu-miR-3084
Sequence

44 - 

uucugccagucuccuucagac

 - 64

Get sequence
Deep sequencing1584 reads, 71 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).