Stem-loop sequence ppy-mir-151b

AccessionMI0020942 (change log)
DescriptionPongo pygmaeus miR-151b stem-loop
Stem-loop
   ucaccagacaccucugauguguca    -cu  uca       -c   aca   aaac 
5'                         gucu   cu   gggcucc  gag   cag    a
                           ||||   ||   |||||||  |||   |||     
3'                         caga   ga   cucgagg  cuc   guc    g
   ----aaaccugggacccaagcaaa    ucu  -ca       ac   -cc   caca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 101636045-101636154 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-151b
ppy-mir-342chr14: 101636286-101636384 [+]
ppy-mir-151bchr14: 101636045-101636154 [-]
Database links

Mature sequence ppy-miR-151b

Accession MIMAT0024394
Sequence

69 - 

uccaggagcucacagucuag

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).