Stem-loop sequence ppy-mir-3912

AccessionMI0020935 (change log)
DescriptionPongo pygmaeus miR-3912 stem-loop
Gene family MIPF0001601; mir-3912
Stem-loop
   gucuaucaagagaugaau                                       u   g 
5'                   gaacaguuaaguuauaacauguccauauuaugcguuagu gug a
                     ||||||||||||||||||||||||||||||||||||||| |||  
3'                   cuugucaauuuaauauuguacagguauaauacgcaauca uac c
   --------------uuuc                                       -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 173988397-173988507 [-]
intergenic
Database links

Mature sequence ppy-miR-3912

Accession MIMAT0024387
Sequence

71 - 

uaacgcauaauauggacaug

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).