Stem-loop sequence ppy-mir-548c

AccessionMI0020927 (change log)
DescriptionPongo pygmaeus miR-548c stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ppy-mir-548c
(2 sentences)

Stem-loop
   ----------------uauug            u      g  c      a       uuac 
5'                      cuauuagguugg gcaaaa ua uugcgg uuuugcu    u
                        |||||||||||| |||||| || |||||| |||||||    u
3'                      gauaauccaacu cguuuu au aacgcc aaaacgg    u
   gucaacaucgguugaaacgua            u      g  u      a       uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 5726325-5726435 [-]
intergenic
Database links

Mature sequence ppy-miR-548c

Accession MIMAT0024379
Sequence

21 - 

aaaaguacuugcggauuuug

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).