Stem-loop sequence ppy-mir-548f

AccessionMI0020926 (change log)
DescriptionPongo pygmaeus miR-548f stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ppy-mir-548f
(2 sentences)

Stem-loop
   uucugaauauauacucaaaa    a            cc        a           uuu 
5'                     uauu gguuggugcaaa  uaauugca uuuuugcaauu   u
                       |||| ||||||||||||  |||||||| |||||||||||   u
3'                     auaa ccaaccacguuu  auuaaugu aaaaacguuaa   a
   ----------------caac    g            uc        c           uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 111326545-111326655 [-]
intergenic
Database links

Mature sequence ppy-miR-548f

Accession MIMAT0024378
Sequence

74 - 

caaaaacuguaauuacuuuug

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).