Stem-loop sequence ppy-mir-548h

AccessionMI0020925 (change log)
DescriptionPongo pygmaeus miR-548h stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ppy-mir-548h
(2 sentences)

Stem-loop
   --        uuagaaaauaa           a            gc         -    c 
5'   guuuguca           uauuagguugg gcaaaaguaauu  gguuuuugu auug u
     ||||||||           ||||||||||| ||||||||||||  ||||||||| ||||  
3'   uaaauagu           auaauucaacc cguuuucauuaa  ccgaaaaua uaac u
   uu        -----------           a            ga         g    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
NW_002923583.1: 1200-1311 [+]
intergenic
Database links

Mature sequence ppy-miR-548h

Accession MIMAT0024377
Sequence

34 - 

aaaaguaauugcgguuuuug

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).