Stem-loop sequence ppy-mir-4798

AccessionMI0020922 (change log)
DescriptionPongo pygmaeus miR-4798 stem-loop
Gene family MIPF0001574; mir-4798
Stem-loop
   ---------------gcauaa           a              ug  aa    -    u 
5'                      uaauaaaguac acuucgguauacuu  ug  uugg cuuu a
                        ||||||||||| ||||||||||||||  ||  |||| ||||  
3'                      auuauuucaug ugaagucauaugaa  ac  aacc gaaa c
   aaguguuugguaaaaaucaac           c              gu  aa    a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr4: 5728493-5728604 [-]
intergenic
Database links

Mature sequence ppy-miR-4798

Accession MIMAT0024374
Sequence

21 - 

uucgguauacuuugugaauugg

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).