Stem-loop sequence ppy-mir-548a

AccessionMI0020921 (change log)
DescriptionPongo pygmaeus miR-548a stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ppy-mir-548a
(2 sentences)

Stem-loop
   auuuaugcacugcag          -ag                   g u     c  c  a 
5'                ggagguauua   uuggugcaaaaguaauugu g uuuug ca ua a
                  ||||||||||   ||||||||||||||||||| | ||||| || ||  
3'                uuuuuauagu   aaccacguuuucauuaacg u aaaac gu au a
   --------------g          cca                   g c     a  a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr6: 19314533-19314643 [+]
intergenic
Database links

Mature sequence ppy-miR-548a

Accession MIMAT0024373
Sequence

35 - 

aaaaguaauugugguuuuug

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).