Stem-loop sequence ppy-mir-3617

AccessionMI0020920 (change log)
DescriptionPongo pygmaeus miR-3617 stem-loop
Gene family MIPF0001477; mir-3617
Stem-loop
   -----------ugucuuacuca   u  u      -      -u   aa        uagaa 
5'                       agg ca agaaag acauag  ugc  gaugggau     a
                         ||| || |||||| ||||||  |||  ||||||||      
3'                       ucc gu ucuuuc uguauc  acg  cuacucug     c
   gacgauuuaccucacacgaggg   c  c      g      cc   -a        uauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 43287391-43287502 [-]
intergenic
Database links

Mature sequence ppy-miR-3617

Accession MIMAT0024372
Sequence

21 - 

aaagacauaguugcaagauggg

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).