Stem-loop sequence ppy-mir-3155a

AccessionMI0020916 (change log)
DescriptionPongo pygmaeus miR-3155a stem-loop
Stem-loop
   cacuuuugaga   -----              a c             g        cc   c 
5'            ugc     cuguuccgggcauc g ucccacugcagag cuggggag  gga a
              |||     |||||||||||||| | ||||||||||||| ||||||||  |||  
3'            acg     gacaagguccguag c agggugacgucuc gacccuuc  ccu g
   -----------   uccuu              g a             g        --   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 6515543-6515654 [+]
intergenic
Database links

Mature sequence ppy-miR-3155a

Accession MIMAT0024368
Sequence

71 - 

caggcucugcagugggaacgga

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).