Stem-loop sequence ppy-mir-548e

AccessionMI0020909 (change log)
DescriptionPongo pygmaeus miR-548e stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ppy-mir-548e
(2 sentences)

Stem-loop
   ugugaucuauggcaua              a        a  u a       -  auua 
5'                 uuuauuagguuggu caaaagua uc c guuuuug cu    c
                   |||||||||||||| |||||||| || | ||||||| ||    g
3'                 agauaguccaacca guuuucau ag g caaaaac ga    u
   -----------uaaga              c        c  u g       u  aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 110341475-110341583 [+]
intergenic
Database links

Mature sequence ppy-miR-548e

Accession MIMAT0024361
Sequence

71 - 

aaaacggugacuacuuuugca

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).