Stem-loop sequence mml-mir-518d-1

AccessionMI0020903 (change log)
DescriptionMacaca mulatta miR-518d-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -------------gaagaucucaugau     u        ga        a     ggc 
5'                            gugac cucuagag  aagcgcuu cuguu   u
                              ||||| ||||||||  |||||||| |||||   a
3'                            cauug gagauuuc  uucgcgaa gauaa   a
   guucuaggcgcaacgaaaagaguuucg     u        uc        g     aaa 
Get sequence
Deep sequencing
417 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49073236-49073345 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518d-1
mml-mir-518a-1chr19: 49066416-49066502 [+]
mml-mir-520gchr19: 49068463-49068552 [+]
mml-mir-518d-1chr19: 49073236-49073345 [+]
mml-mir-518gchr19: 49075909-49075967 [+]
mml-mir-518d-2chr19: 49077769-49077827 [+]
mml-mir-523bchr19: 49080348-49080436 [+]
Database links

Mature sequence mml-miR-518d-5p

Accession MIMAT0024355
Sequence

21 - 

cucuagaggaaagcgcuuacug

 - 42

Get sequence
Deep sequencing507 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-518d-3p

Accession MIMAT0027121
Sequence

59 - 

gaagcgcuucucuuuagagug

 - 79

Get sequence
Deep sequencing76 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).